Category Archives: Blog

Google teaches you Python

The Google’s Python Class is a free class for people with a little bit of programming experience who want to learn Python. The class includes written materials, lecture videos, and lots of code exercises to practice Python coding. https://developers.google.com/edu/python/

Posted in Blog | Leave a comment

Highlighting SNPs for better presentation of your sequence alignment

Imagine the following FASTA alignment: >header1 ATGGATTTATCTGCTCTTCGCGTTGAAGAAGTACAAAATGTCATTAATGCTATGCAGAAAATCTTA >header2 ATGGATTTATCTGCTCTTCGCGTTGAAGAAGTACAAAATGTCATTAATGCTATGCAGAAAATCTTA >header3 ATGGATTTATCTGCTCTTCGCGTTGAAGGAGTACAAAATGTCATTAATGCTATGCAGAAAATCTTA >header4 ATGGATTTATCTGTTCTTCGCGTTGAAGGAGTACAAAATGTCACTAATGCTATGCAGAAAATCTTA Based only in the above alignment, is difficult to instantly identify where the SNPs are. Set dots where we have alignment matches is a very intuitive way … Continue reading

Posted in Blog | Leave a comment

Useful one-line shell commands

SED sed “s/FOO/BAR/g” file.txt #substitute FOO to BAR in the file.txt sed “/PATTERN/s/FOO/BAR/g” file.txt #substitute FOO with BAR only lines which contains PATTERN sed “s/red/blue/g;s/yellow/blue/g” file.txt #substitute red or yellow with blue sed “:a;N;s/\n/ /g;ta” file.txt #substitute line breaks to … Continue reading

Posted in Blog | Tagged , , , | Leave a comment

Explanation of Tajima’s D

Posted in Blog | Leave a comment

Useful Linux one-Liners for bioinformatics [published by: Getting Genetics Done]

Much of the work that bioinformaticians do is munging and wrangling around massive amounts of text. While there are some “standardized” file formats (FASTQ, SAM, VCF, etc.) and some tools for manipulating them (fastx toolkit, samtools, vcftools, etc.), there are … Continue reading

Posted in Blog | Leave a comment

Tools to write and publish papers

Here I summarized some online tools to write and publish papers. • sci-hub.org Download paper http://jane.biosemantics.org/ https://journalsuggester.springer.com/ http://journalfinder.elsevier.com http://journalsuggester.springer.com/ Find journal to publish your paper • etest.vbi.vt.edu/etblast3 Find journal to publish your paper • journalseek.net Information about scientific journals • … Continue reading

Posted in Blog | Leave a comment