Author Archives: hugorody

Find introns correspondent to CDS sequences using genomic sequences and annotation from PLAZA database

I was working with coding-DNA sequences (CDS) data from PLAZA and, at certain point, a co-worker needed not only the exons – which the CDS is constituted – but also the sequences of introns, which is any nucleotide sequence within … Continue reading

Posted in Local Tools | Leave a comment

Shining the dark matter

Genes are just the infinitesimal part of the story. This is a reasonable conclusion after reading “The dark side of the human genome“. Major part of superior species genomes are composed by ‘non-coding’ DNA – known as dark matter – which … Continue reading

Posted in Blog | Leave a comment

Neutral Theory: The Null Hypothesis of Molecular Evolution

In the decades since its introduction, the neutral theory of evolution has become central to the study of evolution at the molecular level, in part because it provides a way to make strong predictions that can be tested against actual … Continue reading

Posted in Blog | Leave a comment

Capture fasta sequences from file using a list of headers using Python

If you have a fasta file and want to capture some specific sequences based on a list of headers you could only use some short bash “grep” command. However, if the fasta file contains sequences in multiple lines this would … Continue reading

Posted in Local Tools | Leave a comment

Google teaches you Python

The Google’s Python Class is a free class for people with a little bit of programming experience who want to learn Python. The class includes written materials, lecture videos, and lots of code exercises to practice Python coding. https://developers.google.com/edu/python/

Posted in Blog | Leave a comment

ORF Finder for DNA sequence Fasta files using Python

Succinctly, an Open Reading Frame (ORF) is a part of DNA sequence in certain frame with the the potential to code for a protein. Because amino acids are coded by triplets of nucleotides, there are three possible frames to look … Continue reading

Posted in Local Tools | Leave a comment

Highlighting SNPs for better presentation of your sequence alignment

Imagine the following FASTA alignment: >header1 ATGGATTTATCTGCTCTTCGCGTTGAAGAAGTACAAAATGTCATTAATGCTATGCAGAAAATCTTA >header2 ATGGATTTATCTGCTCTTCGCGTTGAAGAAGTACAAAATGTCATTAATGCTATGCAGAAAATCTTA >header3 ATGGATTTATCTGCTCTTCGCGTTGAAGGAGTACAAAATGTCATTAATGCTATGCAGAAAATCTTA >header4 ATGGATTTATCTGTTCTTCGCGTTGAAGGAGTACAAAATGTCACTAATGCTATGCAGAAAATCTTA Based only in the above alignment, is difficult to instantly identify where the SNPs are. Set dots where we have alignment matches is a very intuitive way … Continue reading

Posted in Blog | Leave a comment